|
|
||||||||
J Thorac Cardiovasc Surg 2000;120:256-263
© 2000 The American Association for Thoracic Surgery
Surgery for congenital heart disease |
From the Lillie Frank Abercrombie Section of Cardiology, Department of Pediatrics,a and the Section of Cardiovascular Sciences, Department of Medicine,b Baylor College of Medicine, Houston, Tex.
This work was supported in part by grant HL-42550 from the National Institutes of Health and by grant 96G-1188 from the American Heart Association, Texas Affiliate.
Address for reprints: William J. Dreyer, MD, Pediatric Cardiology, MC 2-2280, Texas Childrens Hospital, 6621 Fannin, Houston, TX 77030 (E-mail: wdreyer{at}bcm.tmc.edu ).
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Two groups of animals were included in this study. The first group, designated the CPB group, consisted of 9 animals that underwent CPB with an aortic crossclamp time of 60 minutes and total bypass times of approximately 90 minutes. Before cannulation, each animal was given porcine heparin sodium, 100 U/kg, for anticoagulation. After the aorta was crossclamped, potassium cardioplegic solution (Plegisol, Abbott Laboratories) cooled to 4°C was administered in a prograde fashion until complete arrest of the heart was achieved. The animals were cooled to a rectal temperature of 24°C to 28°C. Flow was maintained during bypass at 60 to 70 mL · kg1 · min1 at a pressure of 40 to 60 mm Hg. After rewarming to 37°C and weaning from CPB, animals received protamine sulfate 1 mg/100 U heparin delivered for reversal of anticoagulation. Animals were once again ventilated with 100% oxygen. Tidal volume and ventilator rate were set to optimize pH and PCO 2. Animals were then maintained with an open chest for 3 (n = 4), 6 (n = 4), or 9 (n = 1) hours. At the end of the reperfusion interval, animals were killed with an overdose of sodium pentobarbital, and their hearts were immediately removed for the collection of tissue samples. Technique was maintained as constant as possible from 1 animal to the next.
The second group consisted of 4 animals designated as sham-bypass controls. These animals served as controls in that they received general anesthesia and mechanical ventilation similar to the animals in group I. In addition, they underwent midline thoracotomy and cannula placement, but they were not placed on CPB. Also, these animals were not subjected to cooling and rewarming or hemodilution. These animals, however, did receive heparin and protamine at a time and in an amount similar to the CPB animals and were maintained with an open chest in a time-matched fashion to those animals undergoing 3 hours of reperfusion in group I.
Approval
The animal studies in this article were reviewed and approved by the Baylor College of Medicine Animal Care and Use Committee. All animals received humane care in compliance with the "Principles of Laboratory Animal Care" formulated by the National Society for Medical Research and the "Guide for the Care and Use of Laboratory Animals" prepared by the Institute of Laboratory Animal Resources and published by the National Institutes of Health (National Institutes of Health publication No. 86-23, revised 1985).
Neutrophil isolation procedure
Forty milliliters of whole blood was collected from the experimental animals into citrate-phosphate-dextrose buffer before CPB, immediately after CPB, and at 3 hours of reperfusion. Granulocyte and mononuclear cell (monocyte-lymphocyte) fractions were isolated on a commercially available single-density gradient (NIM, Cardinal Assoc, Inc) according to manufacturers instructions.
Northern blot analysis
Myocardial biopsy material was immediately snap frozen in liquid nitrogen on collection and stored at 80°C until RNA extraction. RNA extraction was performed from leukocyte samples immediately after leukocyte isolation. RNA was extracted by the acid guanidinium phenol chloroform solvent extraction method. Northern analysis of isolated RNA was subsequently performed with 1% agarose formaldehyde denaturing gels and capillary transfer to nitrocellulose membranes (Immobilon NC, Millipore Corporation) by standard procedures. Loading of RNA was monitored by ethidium bromide staining. Membranes were prehybridized for 2 hours in buffer containing 50% formamide; NaCl, 0.8 mol/L; NaPO4, 50 mmol/L; ethylenediamine tetraacetic acid, 1 mmol/L; 2.5x Denhart solution; and herring sperm DNA. They were then hybridized overnight at 58°C in the same buffer containing 3 x 107 cpm phosphorus 32labeled antisense transcripts of dog IL-6 and dog ICAM-1. After being washed, filters were exposed to Kodak XAR-5 x-ray film, as previously described.
RNA template preparation for reverse transcriptasepolymerase chain reaction
Myocardial tissue samples were first homogenized in Trizol reagent (Gibco-BRL) by means of disposable RNase-free pestles (PGC Scientific). Total RNA was isolated according to the manufacturers instructions.
Reverse transcription and polymerase chain reaction
Reverse transcriptionpolymerase chain reaction (RT-PCR) was used for the detection of transcripts. For the synthesis of complementary DNA (cDNA), 2 µL of extracted RNA was mixed with 6 µg (2 µL of 3 mg/mL) of random primers (Gibco-BRL) and 7.2 µL of diethyl-pyrocarbonatetreated water in the presence of 0.5 U (0.5 µL) of Prime RNase inhibitor (5-3, Inc). This mixture was heated to 95°C for 5 minutes and then snap-cooled on ice. To this we added 4 µL of 5x reverse transcriptase buffer (Gibco-BRL), 2 µL of 100 mmol/L dithiothreitol, 0.8 µL of 25 mmol/L deoxyribonucleoside triphosphates, another 0.5 µL of RNase inhibitor, and 200 U (1 µL) of Moloney murine leukemia virus reverse transcriptase (Gibco-BRL). The samples were incubated at 37°C for 1 hour, followed by 5 minutes at 95°C to inactivate the enzyme. Two microliters of this first-strand cDNA was subjected to PCR amplification to detect ß-actin or IL-6 RNA.
To confirm the isolation of RNA from the tissue samples and confirm that equivalent quantities of RNA were used in each RT-PCR reaction, we subjected 2 µL of cDNA to PCR with ß-actinspecific primers. The template was amplified in a 20-µL reaction, containing 1x PCR buffer (Gibco-BRL), 2.5 mmol/L magnesium chloride, 0.25 mmol/L deoxyribonucleoside triphosphates, 0.5 µmol/L oligonucleotide primers, and 2.5 U of Taq DNA polymerase (Gibco-BRL). After an initial 5-minute incubation at 94°C, 35 rounds of amplification were performed by means of a Stratagene RoboCycler thermal cycler (Stratagene) under the following conditions: 94°C for 45 seconds, 64°C for 45 seconds, and 72°C for 45 seconds. This was followed by a 72°C incubation for 5 minutes.
PCR was used as described for the amplification of ß-actin transcripts to detect IL-6 RNA. All PCR products were detected by 1.75% agarose gel electrophoresis.
Primers were as follows: IL-6: Ca-IL6-1, CTGGTGATGGCTACTGCTTTC; Ca-IL6-2RT, TTTAGCATCTGGACCAGGATC (product = 405 bp) and ß-actin: ß-ACT-1RT, TACATGGCTGGGGTGTTGAA; ß-ACT-4, CATGGATGATGATATCGCCG (product = 399 bp).
In situ hybridization
Immediately after collection, canine myocardial tissue was immersion fixed in B*5 overnight and subsequently embedded in paraffin. Three-micrometer sections were cut with a Leica microtome (Leica Microsystems). Sections for in situ hybridization were hybridized overnight at 42°C with digoxigenin-labeled sense and antisense IL-6 probes. Detection was performed by using alkaline phosphataseconjugated antidigoxigenin antibody.
| Results |
|---|
|
|
|---|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
(TNF)-
, IL-1ß, endotoxin, and cardiac lymph collected after ischemia-reperfusion. Furthermore, their study documented reperfusion-dependent expression of IL-6 mRNA in the viable border zone of a myocardial infarction within 1 hour of reperfusion. Our study has clearly demonstrated for the first time the induction of IL-6 in vivo in canine cardiac myocytes within the first 3 hours of recovery after CPB and before the presence of a significant inflammatory infiltrate. We also demonstrated that IL-6 mRNA induction is not evident in circulating leukocytes before, during, or within the first 3 hours after the CPB procedure as commonly believed. The stimulus for myocyte IL-6 production in this context is unknown, but direct ischemic-hypoxic injury to the cell with subsequent reperfusion is a possibility. The extent of myocardial ischemia induced during CPB was not vigorously explored in this study. Myocardial temperature and pH were not measured directly, nor was myocardial blood flow measured during aortic crossclamping. Nonoxygenated crystalloid cardioplegic solutuion was used in this study rather than blood cardioplegic solution, and the extent to which this may have affected myocardial oxygenation is uncertain. There appeared to be variability between CPB animals in the expression of both IL-6 and ICAM-1 mRNA, and the extent to which variation in the ischemic insult to the myocardium of these animals may have contributed to this observed difference remains speculative.
Alternatively, IL-6 induction could have occurred because of the local release of an upstream inflammatory cytokine. In coronary artery occlusion-reperfusion experiments, resident cardiac mast cells have been demonstrated to release TNF-
,
19 and as discussed above, TNF-
has been demonstrated to stimulate the induction of IL-6 in isolated cardiac myocytes in vitro. Also, recent evidence from rats suggests that the induction of nuclear factor
B occurs in the myocardium subjected to occlusion-reperfusion. IL-6 is known to have a
B response element, and an increase in IL-6 could, in part, be due to the upstream induction of nuclear factor
B.
20
The fact that IL-6 is produced by cardiac myocytes in the context of CPB raises interesting questions as to its physiologic significance, pathophysiologic significance, or both. Despite the documentation of high levels of IL-6 in the plasma after CPB, its role remains largely unknown. Several important possibilities, however, do exist. In this study we documented that ICAM-1 mRNA was increased within the first 3 hours after CPB along with IL-6 expression, suggesting a possible relationship between the two. This observation is important because studies by Youker,
10 Smith,
21 Entman,
22 and their coworkers have demonstrated that neutrophil-induced oxidative injury to cardiac myocytes is dependent on neutrophil-myocyte adherence mediated by neutrophil CD18 expression and myocyte ICAM-1 expression. In vitro cardiac myocyte ICAM-1 expression can be affected by a variety of cytokines, including IL-1, TNF-
, and IL-6. IL-6, however, appears to be the physiologically relevant cytokine as the ability of postischemic cardiac lymph to induce myocyte ICAM-1 expression was completely inhibited by a neutralizing antibody to human IL-6. Also, leukocyte-mediated injury to the myocardium after CPB appears to be a relevant mechanism of myocardial dysfunction after CPB as post-CPB leukocyte depletion appears to enhance left ventricular systolic function.
23
IL-6 may also contribute to myocardial stunning postoperatively. Finkel and associates
13 have demonstrated that the addition of recombinant human IL-6 to the medium bathing isolated hamster papillary muscles resulted in a concentration-dependent, reversible, negative inotropic effect that was blocked by the administration of the nitric oxide synthase inhibitor N -monomethy-L -arginine. Also, a role for cytokine-inducible nitric oxide synthase in cardiac myocytes has been implicated as a mechanism of myocardial contractile dysfunction associated with the systemic inflammatory response syndrome
14 and associated with myocardial infarction.
24 Finally, one study, performed in 3-week-old piglets, suggests that the L -argininenitric oxide pathway is also of pathophysiologic significance to the development of myocardial dysfunction after CPB.
25
Yet one must consider what selective advantage myocardial IL-6 production might have to the myocardium. As an alternative action to the potential mechanisms of myocyte injury detailed above, IL-6 could prove to have a cardioprotective role after CPB by inhibiting cardiac myocyte apoptosis. Apoptosis has recently been recognized as a mechanism of myocyte death in the failing myocardium associated with chronic congestive heart failure.
26 In addition, apoptosis has been identified as a mechanism of myocyte loss in acute ischemia and reperfusion injury in the rabbit heart
27 and in cultured neonatal rat cardiomyocytes exposed to hypoxia.
28 Little is known about the induction of apoptosis in the myocardium protected by hypothermic cardioplegic arrest during CPB; however, a recent study by Aebert and colleagues
29 demonstrated histopathologic evidence of DNA fragmentation by nick end labeling consistent with apoptosis in atrial biopsy specimens from patients undergoing CPB with cardioplegic arrest and moderate hypothermia. His study also demonstrated, by Northern blot analysis, induction of the protooncogenes c- fos and c -jun, which may act as transcription factors for other genes involved in the apoptotic pathway. Whether IL-6 has a regulatory role in the apoptotic pathway of cardiac myocytes is presently unknown, although IL-6 appears to be protective against apoptosis in other cell types.
11,12 In addition, a novel cardiac cytokine, cardiotrophin 1, has recently been described and appears to promote cardiac myocyte survival by activation of an antiapoptotic signaling pathway. Cardiotrophin 1 is a member of the IL-6 family of cytokines, all of which exert their biologic effects through the shared signaling subunit gp130.
30 Whether cardiotrophin 1 and IL-6 share an antiapoptotic effect in the myocardium is at present unknown.
In summary, what is known from this study is that CPB with cold cardioplegic arrest appears to be a sufficient stimulus to induce IL-6 synthesis in cardiac myocytes. Although the exact mechanism of induction and the role that IL-6 performs in the postoperative setting requires further investigation, it appears that the local production of IL-6 could play a pivotal role in the regulation of myocardial function postoperatively.
| References |
|---|
|
|
|---|
, initiating the cytokine cascade in experimental canine myocardial ischemia/reperfusion. Circulation 1998;98:699-710.
B attenuates proinflammatory cytokine and inducible nitric-oxide synthase expression in postischemic myocardium. Biochim Biophys Acta 1998;1406:91-106. [Medline]This article has been cited by other articles:
![]() |
M.-S. Suleiman, M. Hancock, R. Shukla, C. Rajakaruna, and G. Angelini Cardioplegic strategies to protect the hypertrophic heart during cardiac surgery Perfusion, September 1, 2011; 26(1_suppl): 48 - 56. [Abstract] [PDF] |
||||
![]() |
A. M. Grigore, C. F. Murray, H. Ramakrishna, and G. Djaiani A Core Review of Temperature Regimens and Neuroprotection During Cardiopulmonary Bypass: Does Rewarming Rate Matter? Anesth. Analg., December 1, 2009; 109(6): 1741 - 1751. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. M. Bical, Y. Fromes, D. Gaillard, M. Fischer, O. Ponzio, P. Deleuze, M.-F. Gerhardt, and F. Trivin Comparison of the inflammatory response between miniaturized and standard CPB circuits in aortic valve surgery Eur J Cardiothorac Surg, May 1, 2006; 29(5): 699 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Y. P. Wan, A. A. Arifi, S. Wan, J. H. Y. Yip, A. D. L. Sihoe, K.H. Thung, E. M. C. Wong, and A. P. C. Yim Beating heart revascularization with or without cardiopulmonary bypass: Evaluation of inflammatory response in a prospective randomized study J. Thorac. Cardiovasc. Surg., June 1, 2004; 127(6): 1624 - 1631. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ancey, E. Menet, P. Corbi, S. Fredj, M. Garcia, C. Rucker-Martin, J. Bescond, F. Morel, J. Wijdenes, J.-C. Lecron, et al. Human cardiomyocyte hypertrophy induced in vitro by gp130 stimulation Cardiovasc Res, July 1, 2003; 59(1): 78 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caputo, M. Yeatman, P. Narayan, G. Marchetto, R. Ascione, B. C. Reeves, and G. D. Angelini Effect of off-pump coronary surgery with right ventricular assist device on organ function and inflammatory response: a randomized controlled trial Ann. Thorac. Surg., December 1, 2002; 74(6): 2088 - 2095. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Hovels-Gurich, J. F. Vazquez-Jimenez, A. Silvestri, K. Schumacher, R. Minkenberg, J. Duchateau, B. J. Messmer, G. von Bernuth, and M.-C. Seghaye Production of proinflammatory cytokines and myocardial dysfunction after arterial switch operation in neonates with transposition of the great arteries J. Thorac. Cardiovasc. Surg., October 1, 2002; 124(4): 811 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P Vallely, P. G Bannon, C. F Hughes, and L. Kritharides Endothelial Cell Adhesion Molecules and Cardiopulmonary Bypass Asian Cardiovasc Thorac Ann, December 1, 2001; 9(4): 349 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R Holleyman and D. F Larson Apoptosis in the ischemic reperfused myocardium Perfusion, December 1, 2001; 16(6): 491 - 502. [Abstract] [PDF] |
||||
![]() |
J. F. Vazquez-Jimenez, M. Qing, B. Hermanns, B. Klosterhalfen, M. Woltje, R. Chakupurakal, K. Schumacher, B. J. Messmer, G.o. von Bernuth, and M.-C. Seghaye Moderate hypothermia during cardiopulmonary bypass reduces myocardial cell damage and myocardial cell death related to cardiac surgery J. Am. Coll. Cardiol., October 1, 2001; 38(4): 1216 - 1223. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ANN THORAC SURG | ASIAN CARDIOVASC THORAC ANN | EUR J CARDIOTHORAC SURG |
| J THORAC CARDIOVASC SURG | ICVTS | ALL CTSNet JOURNALS |