JTCS KCI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Thoralf M. Sundt, III
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Majumdar, R.
Right arrow Articles by Sundt, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Majumdar, R.
Right arrow Articles by Sundt, T. M., III
Related Collections
Right arrow Congenital - acyanotic
Right arrow Great vessels
Right arrow Valve disease

J Thorac Cardiovasc Surg 2006;131:1301-1305
© 2006 The American Association for Thoracic Surgery


Surgery for Congenital Heart Disease

Bicuspid aortic valve and ascending aortic aneurysm are not associated with germline or somatic homeobox NKX2-5 gene polymorphism in 19 patients

Ramanath Majumdar, PhD a , Marineh Yagubyan, MD b , Gobinda Sarkar, PhD c , Mark E. Bolander, MD c , Thoralf M. Sundt, III, MD a , *

a Division of Cardiovascular Surgery, Mayo Clinic, Rochester, Minn
b Department of Surgery, Mayo Clinic, Rochester, Minn
c Division of Orthopedic Research, Mayo Clinic, Rochester, Minn

Received for publication November 7, 2005; revisions received January 5, 2006; accepted for publication January 25, 2006.

* Address for reprints: Thoralf M. Sundt III, MD, Division of Cardiovascular Surgery, Mayo Clinic, 200 First St SW, Rochester, MN 55905 (Email: Sundt.Thoralf{at}mayo.edu).


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
BACKGROUND: Bicuspid aortic valve is the most common congenital anomaly, occurring in 1% to 2% of the population. It is the most common reason for aortic valve replacement, and such individuals are at significantly increased risk of aortic complications. Despite the clinical significance of bicuspid aortic valve, its genetic basis remains unclear. The homeobox gene NKX2-5 occupies a central position in the hierarchy of cardiac determinants, and mutations in this gene are associated with bicuspid aortic valve in mice. We therefore investigated the presence of mutations in NKX2-5 among patients with bicuspid aortic valve and associated aneurysm.

METHODS: Germline DNA was extracted from peripheral blood leukocytes and somatic DNA from diseased aortic tissues of 19 patients with bicuspid aortic valve and associated aortic aneurysm. Three patients with trileaflet aortic valve and aneurysm served as control subjects. The entire NKX2-5 coding sequence, including intron-exon boundaries, was screened for mutation by means of polymerase chain reaction, followed by DNA sequencing.

RESULTS: Direct sequencing revealed a change in somatic (aortic) DNA 239A->G, leading to synonymous amino acid alteration of Glu21Glu in one patient with bicuspid aortic valve and 1 control subject. There were no other alterations detected in the coding regions of germline or somatic genes. A known polymorphic change in the 3' untranslated region adjacent to exon 2 was detected in both bicuspid aortic valve and control samples. Discrepancies between germline and somatic DNA sequences were observed.

CONCLUSION: Our study fails to demonstrate an association between bicuspid aortic valve and NKX2-5 mutation, as has been seen in mice. Our findings support the importance of sequencing somatic, as well as germline, DNA.



Abbreviations and Acronyms BAV = bicuspid aortic valve; PCR = polymerase chain reaction; UTR = untranslated region



    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Biscuspid aortic valve (BAV) is the most common congenital valve abnormality, with a prevalence of 1% to 2% in the general population. 1,2 Go Although BAV can be functionally normal, it accounts for a substantial disease burden with particular surgical relevance. Most of these individuals will come to surgical aortic valve replacement, whether early or late in life; conversely, approximately 50% of patients coming to aortic valve replacement have BAV. 3–5 Go More recently, attention has been drawn to the association of BAV with ascending aortic dilatation and dissection. Although ascending aortic aneurysms and dissection occur in the absence of valvular abnormality, their incidence is 8- to 10-fold increased among those who have a BAV. 2,3,6–8 Go The burden of this complication falls disproportionately on the young, with a quarter of patients under the age of 40 years presenting with dissection found to have a bicuspid valve. 9 Go

Despite the clinical effect of this condition, little is known of its cause. In the past decade, however, a great deal of progress has been made in understanding cardiac valve development and the role of signaling pathways, such as vascular endothelial growth factor, nuclear factor of activated T-cells calcineurin-dependent 1 (NFATC1), Notch gene homolog 1 (Notch), Wnt oncogene analog (Wnt)/ß catenin, bone morphogenetic protein (BMP)/transforming growth factor, beta (TGF-ß), epidermal growth factor receptor related (ErbB), and neurofibromin 1 (NF1)/ras homolog gene family (Ras), that regulate endothelial proliferation and differentiation in developing and postnatal heart valves. 10 Go A potential role for such pathways in the pathogenesis of BAV disease has been suggested by experiments using gene knockout techniques in which heterozygous ablation of NKX2-5 results in an 8-fold increase in the prevalence of stenotic BAVs in mice. 11 Go Mounting evidence, including familial clustering of BAV 2,12 Go and the association of BAV with a variety of cardiac malformations in human subjects, 13,14 Go supports a genetic cause of the disease. Among the candidates for such a gene, NKX2-5 is appealing given its important role in cardiac development in many organisms, including the frog, chick, mouse, and human. 15–17 Go Nkx2-5 is also known to modulate the extracellular matrix of the aorta during embryonic development, 18 Go an intriguing observation given the frequency with which aortic abnormalities accompany BAV.

Given these observations, we hypothesized that mutations in NKX2-5 will be associated with BAV in human subjects. Furthermore, because somatic NKX2-5 mutations have been recently demonstrated to be associated with congenital cardiac abnormalities, 19 Go we tested our hypothesis by screening both germline and somatic DNA.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Patients and Sample Collection
Samples of germline DNA derived from peripheral blood leukocytes and somatic DNA from the ascending aorta were taken from the Mayo Clinic Cardiovascular Surgery Aortic Aneurysm Tissue Bank. This resource has been built prospectively since March 2003 with Mayo Clinic Institutional Review Board approval. Prospective study patients provide written consent for sample collection, storage, and future confidential analyses as per protocol. Patients are enrolled based on convenience of sample collection from among the total pool of patients undergoing ascending aortic surgery. Because the principle interest of the laboratory is ascending aortic aneurysmal disease, patients in whom availability of discarded aortic tissue samples are anticipated are approached for participation. Both blood samples and aortic tissue (aneurysmal ascending aorta and aortic root) were obtained from 22 patients undergoing ascending aortic replacement for aneurysmal disease. Nineteen of these patients had congenital BAV, and 3 patients had trileaflet aortic valves. As shown in Table 1, the functional pathology of the valve itself was variable. None had associated congenital cardiac anomalies. Tissue samples were snap-frozen in liquid nitrogen and stored at –80°C until DNA was extracted.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characteristics of patients
 
Polymerase Chain Reaction and DNA Sequencing
Genomic DNA was isolated from peripheral blood of the patients by using the standard method of the QIAamp DNA blood maxi kit, according to the manufacturer's protocol (QIAGEN, Almeda, Calif). Genomic DNA from the aorta was extracted with the Wizard DNA extraction kit, according to the manufacturer's protocol (Promega, Madison, Wis). The quality and quantity of isolated DNA were checked on 1% agarose gel and with a spectrophotometer.

The entire NKX2-5 coding sequence, including intron-exon boundaries (Figure 1), was screened for mutation by means of initial polymerase chain reaction (PCR), followed by DNA sequencing. Briefly, PCR was performed in 25 µL total volume containing 100 ng of genomic DNA; 200 µmol/L each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; 0.05 units of Taq DNA polymerase (Invitrogen, Carlsbad, Calif); 1.5 mmol/L MgCl2 in 1x PCR buffer; and 2 µmol/L of each primer. Primer sequences covering both exons and intron-exon boundaries (Figure 1) of the NKX2-5 gene are as follows: 1AF, CGGCACCATGCAGGGAAG; 1AR, AGGGTCCTTGGCTGGGTCGG (PCR size 404 bp); 1BF, CCTAAACCTGGAACAGCAGC; 1BR, TCCTGGCCCTGAGTTTCTTG (355 bp); 2AF, GCGCTCCGTAGGTCAAGC; 2AR, TAGGGATTGAGGCCCACG (472 bp); 2BF, GTTCCAGAACCGGCGCTACAAGTG; and 2BR, GCGCGTGGGACAGAAAAAGTTCCT (573 bp).


Figure 1
View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. Selection of primers covering entire exon-intron boundaries of the NKX2-5 gene. Details of the primers' sequences (1AF, 1AR, 1BF, 1BR, 2AF, 2AR, 2BF, and 2BR) and the PCR product sizes are given in the text. UTR, Untranslated region.

 
The amplification was carried out with a hot predenaturation start for 3 minutes at 94°C and subsequently with 35 cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 62°C to 65°C (different primer sets need different annealing temperature for PCR amplification), and extension for 30 seconds at 72°C. The PCR products were electrophoresed on 1% agarose gel. The gel-isolated PCR products were analyzed by using double-strand cycle sequencing with the BigDye Terminator v3.1 kit and ABI 3100 Genetic analyzer (Applied Biosystems, Foster City, Calif). Sequences were analyzed with SeqMan (DNASTAR, Madison, Wis) and Chroma software (Version 1.45; Griffith University, Southport, Australia). Both sense and antisense strands of the PCR products were sequenced, and NM004387 from Genbank was used as a reference control sequence.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Direct sequencing of germline DNA derived from peripheral blood leukocytes did not reveal any alteration in the protein-coding regions. A known polymorphic alteration (T1212G) in the 3' untranslated region (UTR) adjacent to exon 2 was identified in 4 patients with BAV and 2 control subjects (Table 2). There was no correlation between this DNA sequence variation and the phenotype/functional pathology of the valve.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Detection of sequence variation in NKX2-5
 
Sequence analysis of NKX2-5 fragments generated from DNA extracted from the excised aorta of the above individuals was performed to determine the presence of somatic mutations in the conotruncal tissues. A change from an A to G residue at position 239 (per Genebank reference sequence NM004387) was identified in 1 patient with BAV and 1 control subject. This 239 A->G transition causes a synonymous amino acid alteration of Glu21Glu, as reported earlier. 19 Go This alteration was not present in the corresponding individual's germline DNA. A polymorphism (T1212G) in the 3'-UTR adjacent to exon 2 was identified in aortic DNA among 6 patients with BAV and 1 control subject. Only 2 of the 6 patients with BAV exhibited the same polymorphism in their germline DNA. The control subject with this polymorphism exhibited the same in germline DNA. Conversely, 2 of the patients with BAV and 1 control subject exhibited this polymorphism in DNA derived from peripheral blood leukocytes but not in that derived from the ascending aorta (Table 2).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The results of this study demonstrate that among the 19 individuals with BAV and aneurysm tested, polymorphism in the coding region of NKX2-5 is not responsible for the valvular malformation. Germline DNA extracted from peripheral blood leukocytes demonstrated no abnormality in the coding regions, and the only polymorphism identified in the 3'-UTR was present in both patients with BAV and control subjects. Somatic DNA extracted from tissue of conotruncal origin (ascending aorta) demonstrated this same polymorphism in the 3'-UTR in 6 study patients and 1 control subject. Furthermore, consonance between germline and somatic sequences was poor. A single nucleotide polymorphism in somatic DNA in the coding region was identified in 2 individuals; however, this synonymous amino acid change (it signaled no change in protein sequence) was present both in 1 patient with BAV and a control subject with a trileaflet valve. These polymorphisms have been previously reported in patients with complex congenital heart disease, including idiopathic atrioventricular block, 19 Go as well as atrial septal defect and tetralogy of Fallot. They have also been identified among individuals without apparent cardiac disease. 19 Go

The limitations of this study must be recognized. The strong association of BAV with NKX2-5 mutation in mice made this an important candidate gene in our series. A negative study result with our small population size cannot rule out mutation in NKX2-5 as a possible cause of a minor percentage of cases of BAV. Also, our selection bias in favor of BAV associated with aneurysmal disease might have inadvertently reduced our chances of identifying an association if, for example, the phenotype in human subjects associated with such a mutation were to be isolated BAV. Of note, however, our study sample did include patients with the full spectrum of functional pathology. It is also possible that a somatic mutation exists in the valve tissue but not in the associated ascending aorta. This is, in our view, unlikely because these structures are developmentally derived from a common cell population.

The events involved in the developmental process of the ascending aorta, including BAV formation, are poorly understood. It has been suggested that abnormalities in components of the extracellular matrix or aberrant vascular matrix remodeling might contribute to abnormal valvulogenesis and a structurally weakened aortic root. 14 Go The aortic valve leaflets originate from mesenchymal outgrowths termed cardiac cushions arising from regional thickenings of the cardiac jelly, the extracellular matrix that resides between the myocardium and endocardium of the primitive heart tube. 20 Go Further contribution of neural crest cells in the development of the ascending aorta, including the aortic valve, is recognized. 21 Go Because BAV is often accompanied by congenital abnormalities of the aorta, the process underlying BAV formation might involve more than just the inappropriate fusion of adjacent leaflets and might represent a genetic disease that affects the entire aortic root, 14 Go as well as the wall. 22 Go

A homeodomain transcription factor, NKX2-5 in the human subject maps to chromosome 5q34 and consists of 2 exons coding a protein of 324 amino acids. Previous studies have shown 5 other NKX2-5 mutations conferring a range of cardiac abnormalities, including severe arterioventricular conduction blocks, ventricular septal defect, left ventricular hypertrophy, tetralogy of Fallot, double-outlet right ventricle, subvalvular aortic stenosis, and tricuspid valve abnormality. 23–28 Go The frequency of these mutations in the general population is unknown. In knockout mice homozygous deletion of Nkx2-5 is lethal; however, heterozygous mutation of Nkx2-5 results in impaired cardiac development, thus demonstrating an essential role for this gene in normal heart morphogenesis and function. 23–26 Go Previous work has demonstrated that heterozygous mutation in the Nkx2-5 gene increased the frequency of BAV in the mice from 1.4% to 11%. 11 Go The presence of BAVs in mice was strictly dependent on genetic background, being found only in the C57B1/6 strain, suggesting an influence of another genetic modifier.

Given the frequency of BAV in the population and the observed phenotypic variability, including both valve morphology and the presence or absence of associated aortic aneurysmal disease, as well as the association of BAV with a variety of complex congenital syndromes 2,19,22,28 Go in human subjects, it is likely that more than one genetic abnormality could lead to this congenital malformation. Other candidate genes have been proposed. An association of mutations in the NOTCH1 gene with a complex of cardiac anomalies, including ventricular septal defect, hypoplastic left ventricle, mitral atresia, and double-outlet right ventricle, as well as BAV and valvular calcification among many affected family members, has recently been reported. 29 Go Of note, ascending aortic aneurysm was not among the phenotypic characteristics described in these families. Alterations in endothelial nitric oxide synthase levels have also been associated with BAV formation in mice, 30 Go supporting genetic heterogeneity in the cause of BAV in the murine system. Abnormalities in NKX2-5 remain a relevant possibility as well in some cases. Although we did not detect any mutation in the protein coding sequence of NKX2-5 from patients with BAV, it is possible that a relevant mutation could be present elsewhere in the NKX2-5 gene, such as a promoter, an intron, or the 3'-UTR. Finally, there might be an association of BAV with NKX2-5–related signaling cascade or network either within an upstream regulator or a downstream target. Alternatively, the absence of NKX2-5 involvement in human BAV might reflect a different developmental pattern of ascending aorta in mice and human subjects.


    Footnotes
 
This work was supported in part by an SS-50 award to Dr Sundt from the Department of Surgery, Mayo Clinic, and by National Institutes of Health grant AR47974 awarded to Dr Mark E. Bolander.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Roberts WC. The congenitally bicuspid aortic valve. A study of 95 autopsy cases. Am J Cardiol 1970;26:72-83.[Medline]
  2. Cripe L, Adelfinger G, Martin LJ, Shooner K, Woodrow Benson D. Bicuspid aortic valve is heritable. J Am Coll Cardiol 2004;44:138-143.[Abstract/Free Full Text]
  3. Ward C. Clinical significance of the bicuspid aortic valve. Heart 2000;83:81-85.[Free Full Text]
  4. Guiney TE, Davies MJ, Parker DJ, et al. The aetiology and course of isolated severe aortic regurgitation. Br Heart J 1987;58:358-368.[Abstract/Free Full Text]
  5. Olson LJ, Subramanian R, Edwards WD. Surgical pathology of pure aortic insufficiency. a study of 225 cases. Mayo Clin Proc 1984;59:835-841.[Medline]
  6. Fedak PW, Verma S, David TE, Leask RL, Weisel RD, Butany J. Clinical and pathophysiological implications of a bicuspid aortic valve. Circulation 2002;106:900-904.[Free Full Text]
  7. Sabet HY, Edwards WD, Tazelaar HD, Daly RC. Congenitally bicuspid aortic valves. a surgical pathology study of 542 cases (1991 through 1996) and a literature review of 2,715 additional cases. Mayo Clin Proc 1999;74:14-26.[Medline]
  8. Edwards WD, Leaf DS, Edwards JE. Dissecting aortic aneurysm associated with congenital bicuspid aortic valve. Circulation 1978;57:1022-1025.[Abstract/Free Full Text]
  9. Gore I. Dissecting aneurysms of the aorta in persons under forty years of age. AMA Arch Pathol 1953;55:1-13.[Medline]
  10. Armstrong EJ, Bischoff J. Heart valve development endothelial cell signaling and differentiation. Circ Res 2004;95:459-470.[Abstract/Free Full Text]
  11. Biben C, Weber R, Kesteven S, et al. Cardiac septal and valvular dysmorphogenesis in mice heterozygous for mutations in homeobox gene NKX2-5. Circ Res 2000;87:888-895.[Abstract/Free Full Text]
  12. Huntington K, Hunter AG, Chan KL. A prospective study to assess the frequency of familial clustering of congenital bicuspid aortic valve. J Am Coll Cardiol 1997;40:1809-1812.
  13. Goh DL, Han LF, Judge DP, et al. Linkage of familial bicuspid aortic valve with aortic aneurysm to chromosome 15q [abstract]. Am J Hum Genet 2002;71(Suppl):211.
  14. Fedak PWM, David TE, Borger M, Verma S, Butany J, Weisel RD. Bicuspid aortic valve disease. recent insights in pathophysiology and treatment. Exp Rev Cardiovasc Ther 2005;3:295-308.
  15. Srivastava D, Olson EN. A genetic blueprint for cardiac development. Nature 2000;407:221-226.[Medline]
  16. Harvey RP. NK-2 homeobox genes and heart development. Dev Biol 1996;178:203-216.[Medline]
  17. Akazawa H, Komuro I. Cardiac transcription factor Csx/Nkx2-5. its role in cardiac development and diseases. Pharmacol Ther 2005;107:252-268.[Medline]
  18. Ponticos M, Partridge T, Black CM, Abraham DJ, Bou-Gharios G. Regulation of collagen Type 1 in vascular smooth muscle cells by competition between Nkx2.5 and dEF1/ZEB1. Mol Cell Biol 2004;24:6151-6161.[Abstract/Free Full Text]
  19. Reamon-Buettner SM, Borlak J. Somatic NKX2-5 mutations as a novel mechanism of disease in complex congenital heart disease. J Med Genet 2004;41:684-690.[Abstract/Free Full Text]
  20. Paranya G, Vineberg S, Dvorin E, et al. Aortic valve endothelial cells undergo transforming growth factor ß–mediated and non-transforming growth factor ß–mediated transdifferentiation in vitro. Am J Pathol 2001;159:1335-1343.[Medline]
  21. Kelly RG. Molecular inroads into the anterior heart field. Trends Cardiovasc Med 2005;15:51-56.[Medline]
  22. Duran AC, Frescura C, Sans-Coma V, Angelini A, Basso C, Thiene G. Bicuspid aortic valves in hearts with other congenital heart disease. J Heart Valve Dis 1995;4:581-590.[Medline]
  23. Tanaka M, Chen Z, Bartunkova S, Yamasaki N, Izumo S. The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 1999;126:1269-1280.[Abstract]
  24. Schott JJ, Benson DW, Basson CT, et al. Congenital heart disease caused by mutations in the transcription factor NKX2-5. Science 1998;28:108-111.
  25. Benson DW, Silberbach GM, Kavanaugh McHugh A, et al. Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J Clin Invest 1999;104:1567-1573.[Medline]
  26. Goldmuntz E, Geiger E, Benson DW. NKX2.5 mutations in patients with tetralogy of Fallot. Circulation 2001;104:2565-2568.[Abstract/Free Full Text]
  27. Elliott DA, Kirk EP, Yeoh T, et al. Cardiac homebox gene NKX2-5 mutations and congenital heart disease. associations with atrial septal defect and hypoplastic left heart syndrome. J Am Coll Cardiol 2003;41:2072-2076.[Abstract/Free Full Text]
  28. Sarkozy A, Conti E, Neri C, et al. Spectrum of atrial septal defects associated with mutations of NKX2.5 and GATA4 transcription factors. J Med Genet 2005;42:e16.[Free Full Text]
  29. Garg V, Muth AN, Ransom JF, et al. Mutations in NOTCH1 cause aortic valve disease. Nature 2005;437:270-274.[Medline]
  30. Lee TC, Zhao YD, Courtman DW, Stewart DJ. Abnormal aortic valve development in mice lacking nitric oxide synthase. Circulation 2000;101:2345-2348.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Thoralf M. Sundt, III
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Majumdar, R.
Right arrow Articles by Sundt, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Majumdar, R.
Right arrow Articles by Sundt, T. M., III
Related Collections
Right arrow Congenital - acyanotic
Right arrow Great vessels
Right arrow Valve disease


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS